Review



cloning vector pbluescript ii sk (+) [pbs sk  (Agilent technologies)


Bioz Verified Symbol Agilent technologies is a verified supplier
Bioz Manufacturer Symbol Agilent technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Agilent technologies cloning vector pbluescript ii sk (+) [pbs sk
    Cloning Vector Pbluescript Ii Sk (+) [Pbs Sk, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+vector+pbluescript+ii+sk+(+)+%5Bpbs+sk/pm33231432-49-0-11
    Average 90 stars, based on 1 article reviews
    cloning vector pbluescript ii sk (+) [pbs sk - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Helicobacter pylori rocF Is Required for Arginase Activity and Acid Protection In Vitro but Is Not Essential for Colonization of Mice or for Urease Activity
    Article Snippet: The oligonucleotide primers, plasmids, and bacterial strains are listed in Table . table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Oligonucleotide primer, plasmid, or strain Coordinates in rocF a Relevant genotype or description DNA sequence (5′ to 3′) Source or reference Primers b RocF-F3 (for) −149–−130 GC CTGCAG TATTGGGGTGTTTTTCTATC ( Pst I site underlined) RocF-R13 (for) 18–37 AA CTGCAG AAGCAGAGTTAGGAGCG ( Pst I site underlined) RocF-F4 (for) 204–223 AAATCTGATCCCTTGCATGA RocF-R14 (rev) 339–360 CG GGATCC GCATGCGCGTCTAAATAC ( Bam HI site underlined) RocF-R6 (rev) 554–573 TTCGCTCTGTTCGGTGCTTC RocF-R15 (for) 562–580 CG GGATCC GAACAGAGCGAAAGAGATG ( Bam HI site underlined) RocF-R17 (rev) 691–708 GTCCAAATCCAAACTGAG RocF-R16 (rev) 898–915 CG GAATTC GATGAGATCTAAGATCTC ( Eco RI site underlined) RocF-R5 (rev) 987–1006 GG ATCGAT CTTTTTCAACCTTTTATCGT ( Cla I site underlined) Kan-H16 (rev) NA CGGTATAATCTTACCTATCACCTCA Kan-K4 (rev) NA TCCAATTCACTGTTCCTT Kan-K5 (for) NA TATATTTAAAAATGACGG Kan-K8 (for) NA TTTGACTTACTGGGGATCAAGCCTG Plasmids (parent) pBluescript II SK (−) Ap r , cloning vector Stratagene pBS- rocF (pBluescript II SK) Ap r , 1,154-bp rocF PCR product (nucleotides −149 to 1006) cloned into the Pst I and Cla I sites This study pBS- rocF::aphA3 (pBluescript II SK) Ap r Kn r , 1.2-kb Eco RI aphA3 cassette from pHP1 ligated to the Eco RI site of rocF in pBS- rocF This study pHP1 (pUC19) Ap r Kn r , source of aphA3 cassette H. Kleanthous pILL570 Sp r , cloning vector 11 pILL570 Not (pILL570) Sp r , Not I and Eco RI sites have been introduced between the Cla I and Hin dIII sites in the pILL570 polylinker This study pILL600 Kn r , source of aphA3 cassette 12 pILL235 (pILL570 Not) Sp r , 676-bp rocF spliced PCR products (nucleotides 18 to 339 and 562 to 915) This study pILL236-2 (pILL570) Sp r Kn r , aphA3 cassette from pILL600 ligated to the Bam HI site in rocF in pILL235 This study Strains E. coli DH5α F − supE44 ΔlacU169 (φ80 lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Bethesda Research Laboratories H. pylori 26695 WT, genome sequenced 4 , 34 26695 rocF::aphA3 26695 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study N6 WT, naturally transformable laboratory strain 6 N6 236-2 N6 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study N6 rocF::aphA3 N6 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study SS1 WT (mouse-adapted) 13 SS1 236-2 SS1 allelic exchange arginase ( rocF ) mutant by using pILL236-2 This study SS1 rocF::aphA3 SS1 allelic exchange arginase ( rocF ) mutant by using pBS- rocF::aphA3 This study Open in a separate window a +1 refers to the A residue in the start codon of rocF .

    Cloning:

    Article Title: A Tale of Two Transitions: The Unfolding Mechanism of the prfA RNA Thermosensor.
    Article Snippet: RNA thermosensors (RNATs), found in the 5′ untranslated region (UTR) of some bacterial messenger RNAs (mRNAs), control the translation of the downstream gene in a temperature-dependent manner.. In Listeria monocytogenes, the expression of a key transcription factor, PrfA, is mediated by an RNAT in its 5′ UTR.. PrfA functions as a master regulator of virulence in L. monocytogenes, controlling the expression of many virulence factors.

    Plasmid Preparation:

    Article Title: A Tale of Two Transitions: The Unfolding Mechanism of the prfA RNA Thermosensor.
    Article Snippet: RNA thermosensors (RNATs), found in the 5′ untranslated region (UTR) of some bacterial messenger RNAs (mRNAs), control the translation of the downstream gene in a temperature-dependent manner.. In Listeria monocytogenes, the expression of a key transcription factor, PrfA, is mediated by an RNAT in its 5′ UTR.. PrfA functions as a master regulator of virulence in L. monocytogenes, controlling the expression of many virulence factors.



    Similar Products

    cloning vector pbluescript ii sk (+) [pbs sk  (Agilent technologies)
    90
    Agilent technologies cloning vector pbluescript ii sk (+) [pbs sk
    Cloning Vector Pbluescript Ii Sk (+) [Pbs Sk, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+vector+pbluescript+ii+sk+(+)+%5Bpbs+sk/pm33231432-49-0-11
    Average 90 stars, based on 1 article reviews
    cloning vector pbluescript ii sk (+) [pbs sk - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results